| Annotated protein: | AP-2 complex subunit mu (AP-2 mu chain) (Adaptor protein complex AP-2 subunit mu) (Adaptor-related protein complex 2 subunit mu) (Clathrin assembly protein complex 2 mu medium chain) (Clathrin coat assembly protein AP50) (Clathrin coat-associated protein AP50) (Mu2-adaptin) (Plasma membrane adaptor AP-2 50 kDa protein). Gene symbol: AP2M1. Taxonomy: Mus musculus (Mouse). Uniprot ID: P84091 |
| antibody wiki: | |
| SynGO gene info: | SynGO data @ AP2M1 |
| Ontology domain: | Biological Process |
| SynGO term: | postsynaptic neurotransmitter receptor endocytosis (GO:0098884) |
| Synapse type(s): | hippocampus, glutamatergic |
| Annotated paper: | Matsuda S, et al. "Stargazin regulates AMPA receptor trafficking through adaptor protein complexes during long-term depression" Nat Commun. 2013;4:2759 PMID:24217640 |
| Figure(s): | Fig.5, S5, 7 |
| Annotation description: | Background: paper shows that stargazin regulates AMPAR trafficking via differential interactions with AP-2 and AP-3 depending on the phosphorylation state of stargazin. The interaction of stargazin with both AP-3 and AP-2 seems to be needed for NMDA-induced AMPA receptor endocytosis, a chemical LTD model, in hippocampal neurons. This is unexpected since only AP-2 complex is known to be involved in clathrin-mediated endocytosis. In further experiments the authors show that it is not the endocytosis that is regulated by AP-3, but the targeting to the lysosomal compartment; if AP-3 function is perturbed the AMPARs are no longer degraded, but travel back to the plasma membrane preventing a run-down of the cell surface receptor levels. Fig 5-S5: "Knockdown of AP-2 or AP-3A inhibits the NMDA-induced removal of surface AMPA receptors" Fig.7: "Suppression of hippocampal CA1-LTD by inhibiting the interaction of STG with AP-2 or AP-3A" This figure supports the relevance of the AP-2 role in in vivo synapses (AP-2 function is perturbed indirectly). Note: authors knocked down two members of the AP-2 complex, beta2 and mu1: "The function of AP-2β can be partly compensated by a highly similar subunit, AP-1β (ref. 23), which is normally incorporated into AP-1. Therefore, to further clarify the specific roles had by AP-2, we knocked down AP-2μ." This makes an argument to annotate other members of the AP-2 complex to the same term. Note: the paper mentions shRNA against AP-2 mu2 subunit. This subunit does not exist in Unitprot. This is traced back to AP-2 subunit mu1 (PMID:12952941) via blast using the two shRNA sequences (>mu1:AAGUGGAUGCCUUUCGGGUCA, >mu2:AACACAGCAACCUCUACUUGG). |
| Evidence tracking, Biological System: | Intact tissue Cultured neurons |
| Evidence tracking, Protein Targeting: | RNAi / shRNA |
| Evidence tracking, Experiment Assay: | Wide-field fluorescence |
| Annotator(s): | Peter McPherson (ORCID:0000-0001-7806-5662) |
| Lab: | Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montreal, QC H3A 2B4, Canada |
| SynGO annotation ID: | 2225 |
| Dataset release (version): | 20231201 |
| View annotation as GO-CAM model: |  |